| Basic information from miRBase |
| hairpin accession number: MI0015737 |
| Located between position 3055652 and 3055700 on chromosome 3q strand + |
| Overlapping with sense strand of (3UTR 5). |
| (Ensemble: ENSCINT00000007652) |
| mature miRNAs for MI0015737: |
| cin-miR-4181-5p (MIMAT0016794): ATTGTGTCAGCCTGTCGTTCT |
| cin-miR-4181-3p (MIMAT0016795): GAACGTCAGGCTGACACAAT |
| You can find this miRNA in ENTREZGENE: mir4181 (accession: 100498995) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |