Basic information from miRBase |
hairpin accession number: MI0015737 |
Located between position 3055652 and 3055700 on chromosome 3q strand + |
Overlapping with sense strand of (3UTR 5). |
(Ensemble: ENSCINT00000007652) |
mature miRNAs for MI0015737: |
cin-miR-4181-5p (MIMAT0016794): ATTGTGTCAGCCTGTCGTTCT |
cin-miR-4181-3p (MIMAT0016795): GAACGTCAGGCTGACACAAT |
You can find this miRNA in ENTREZGENE: mir4181 (accession: 100498995) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" ![]() |