Basic information from miRBase |
hairpin accession number: MI0008735 |
Located between position 59389341 and 59389426 on chromosome 19 strand + |
mature miRNAs for MI0008735: |
ptr-miR-524 (MIMAT0008208): GAAGGCGCTTCCCTTTGGAGT |
You can find this miRNA in ENTREZGENE: MIR524 (accession: 100316390) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |