| Basic information from miRBase |
| hairpin accession number: MI0011447 |
| Located between position 26149888 and 26149962 on chromosome 29 strand - |
| Overlapping with sense strand of (intron 5). |
| (Ensemble: ENSBTAT00000024536) |
| mature miRNAs for MI0011447: |
| bta-miR-449d (MIMAT0011962): GAAGGCTGTGTGCTGTGGAG |
| You can find this miRNA in ENTREZGENE: MIR449D (accession: 100313194) |
| References |
| [1]Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ, PLoS One. 4:e6349(2009)., "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" |