Basic information from miRBase |
hairpin accession number: MI0008802 |
Located between position 159424440 and 159424534 on chromosome 7 strand - |
Overlapping with sense strand of PTPRN2 (intron 1). |
(Ensemble: ENSPTRT00000036920) |
mature miRNAs for MI0008802: |
ptr-miR-595 (MIMAT0008265): GAAGTGTGCCGTGGTGTGTCT |
You can find this miRNA in ENTREZGENE: MIR595 (accession: 100316350) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |