| Basic information from miRBase |
| hairpin accession number: MI0008802 |
| Located between position 159424440 and 159424534 on chromosome 7 strand - |
| Overlapping with sense strand of PTPRN2 (intron 1). |
| (Ensemble: ENSPTRT00000036920) |
| mature miRNAs for MI0008802: |
| ptr-miR-595 (MIMAT0008265): GAAGTGTGCCGTGGTGTGTCT |
| You can find this miRNA in ENTREZGENE: MIR595 (accession: 100316350) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |