| Basic information from miRBase |
| hairpin accession number: MI0015736 |
| Located between position 397164 and 397248 on chromosome scaffold_26 strand - |
| mature miRNAs for MI0015736: |
| cin-miR-4180-5p (MIMAT0016792): TCTGCCATACCCTGAGACTTT |
| cin-miR-4180-3p (MIMAT0016793): GAATCTTACTGTATGGCAG |
| You can find this miRNA in ENTREZGENE: mir4180 (accession: 100498994) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |