Basic information from miRBase |
hairpin accession number: MI0008818 |
Located between position 110066474 and 110066571 on chromosome 12 strand - |
Overlapping with sense strand of (intron 1). |
(Ensemble: ENSPTRT00000009928) |
mature miRNAs for MI0008818: |
ptr-miR-619 (MIMAT0008281): GACCTGGACATGTTTGTGCCCAGT |
You can find this miRNA in ENTREZGENE: MIR619 (accession: 100316248) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |