miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008818
Located between position 110066474 and 110066571 on chromosome 12 strand -
Overlapping with sense strand of (intron 1).
(Ensemble: ENSPTRT00000009928)
mature miRNAs for MI0008818:
         ptr-miR-619 (MIMAT0008281): GACCTGGACATGTTTGTGCCCAGT
You can find this miRNA in ENTREZGENE: MIR619 (accession: 100316248)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"