miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0012803
Located between position 11703520 and 11703600 on chromosome 13 strand +
Overlapping with sense strand of LOC100062129 (intron 4).
(Ensemble: ENSECAT00000018924)
mature miRNAs for MI0012803:
         eca-miR-590-5p (MIMAT0013058): GAGCTTATTCATAAAAGTACAG
         eca-miR-590-3p (MIMAT0013059): TAATTTTATGTATAAGCTAGT
You can find this miRNA in ENTREZGENE: MIR590 (accession: 100314858)

References
[1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach"