| Basic information from miRBase |
| hairpin accession number: MI0007855 |
| Located between position 51638224 and 51638320 on chromosome 3 strand + |
| Overlapping with sense strand of XM_001088107.1 (intron 4). |
| (Ensemble: ENSMMUT00000008680) |
| mature miRNAs for MI0007855: |
| mml-miR-590-5p (MIMAT0006450): GAGCTTATTCATAAAAGTGCAG |
| mml-miR-590-3p (MIMAT0006451): TAATTTTATGTATAAGCTGGT |
| You can find this miRNA in ENTREZGENE: MIR590 (accession: 100315588) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |