| Basic information from miRBase |
| hairpin accession number: MI0008416 |
| Located between position 211627123 and 211627218 on chromosome 1 strand - |
| Overlapping with sense strand of XM_001149824.1 (3UTR 2). |
| (Ensemble: ENSPTRT00000003850) |
| mature miRNAs for MI0008416: |
| ptr-miR-1182 (MIMAT0007950): GAGGGTCTTGGGAGGGATGTGAC |
| You can find this miRNA in ENTREZGENE: MIR1182 (accession: 100316423) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |