| Basic information from miRBase |
| hairpin accession number: MI0008592 |
| Located between position 56527383 and 56527461 on chromosome 20 strand - |
| mature miRNAs for MI0008592: |
| ptr-miR-296 (MIMAT0008079): GAGGGTTGGGTGGAGGCTCTCC |
| You can find this miRNA in ENTREZGENE: MIR296 (accession: 100316414) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |