| Basic information from miRBase |
| hairpin accession number: MI0012857 |
| Located between position 45210449 and 45210526 on chromosome 22 strand - |
| Overlapping with antisense strand of NPEPL1 (intron 11). |
| (Ensemble: ENSECAT00000023994) |
| mature miRNAs for MI0012857: |
| eca-miR-296 (MIMAT0013107): GAGGGTTGGGTGGAGGCTTTCC |
| You can find this miRNA in ENTREZGENE: MIR296 (accession: 100314887) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |