Basic information from miRBase |
hairpin accession number: MI0006284 |
Located between position 32213393 and 32213514 on chromosome 8 strand - |
mature miRNAs for MI0006284: |
mmu-miR-1186 (MIMAT0005836): GAGTGCTGGAATTAAAGGCATG |
You can find this miRNA in MGI: Mir1186 (accession: 3783360) |
References |
[1]Calabrese JM, Seila AC, Yeo GW, Sharp PA, Proc Natl Acad Sci U S A. 104:18097-18102(2007)., "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" ![]() |
[2]Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A, Mol Hum Reprod. 16:463-471(2010)., "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" ![]() |
more data |
Polymorphism data from Patrocles |