| Basic information from miRBase |
| hairpin accession number: MI0015931 |
| Located between position 69493248 and 69493332 on chromosome 14 strand - |
| Overlapping with sense strand of (exon 1). |
| (Ensemble: ENSSSCT00000019965) |
| mature miRNAs for MI0015931: |
| ssc-miR-1296 (MIMAT0017976): GAGTGGGGTTTTGACCCTAACC |
| You can find this miRNA in ENTREZGENE: MIR1296 (accession: 100526395) |
| References |
| [1]Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R, BMC Genomics. 11:275(2010)., "Deciphering the porcine intestinal microRNA transcriptome" |