miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0004524
Located between position 68828010 and 68828078 on chromosome 7 strand -
mature miRNAs for MI0004524:
         mmu-miR-344d-1* (MIMAT0014819): AGTCAGGCTGCTGGCTATACACCA
         mmu-miR-344d (MIMAT0014808): GATATAACCACTGCCAGACTGA
You can find this miRNA in ENTREZGENE: Mir344d-1 (accession: 100526544)

References
[1]Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E, Genome Res. 16:1289-1298(2006)., "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
[2]Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"