| Basic information from miRBase |
| hairpin accession number: MI0008621 |
| Located between position 51253530 and 51253622 on chromosome 19 strand - |
| Overlapping with sense strand of (intron 1). |
| (Ensemble: ENSPTRT00000064847) |
| mature miRNAs for MI0008621: |
| ptr-miR-330 (MIMAT0008102): GCAAAGCACACGGCCTGCAGAGA |
| You can find this miRNA in ENTREZGENE: MIR330 (accession: 100316142) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |