| Basic information from miRBase |
| hairpin accession number: MI0013170 |
| Located between position 267848307 and 267848386 on chromosome 1 strand + |
| Overlapping with sense strand of (exon 1). |
| (Ensemble: ENSSSCT00000020360) |
| mature miRNAs for MI0013170: |
| ssc-miR-455 (MIMAT0013960): GCAGTCCATGGGCATATACAC |
| You can find this miRNA in ENTREZGENE: MIR455 (accession: 100498752) |
| References |
| [1]Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B, Anim Genet. 41:159-168(2010)., "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" |