Basic information from miRBase |
hairpin accession number: MI0005824 |
Located between position 13747609 and 13747697 on chromosome 2L strand - |
mature miRNAs for MI0005824: |
dme-miR-1002-5p (MIMAT0005483): TTAAGTAGTGGATACAAAGGGCGA |
dme-miR-1002-3p (MIMAT0020864): GCATTGTATGACCTACTTAACT |
References |
[1]Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" |
more data |
Data from CoGemiR |