| Basic information from miRBase |
| hairpin accession number: MI0017738 |
| Located between position 18306535 and 18306660 on chromosome 3R strand + |
| Overlapping with sense strand of Nrx-1-RA (3UTR 13). |
| (Ensemble: FBtr0084256) (FlyBase: FlyBase) |
| mature miRNAs for MI0017738: |
| dme-miR-4952-5p (MIMAT0020166): GCCGGATCCGGATGTCGCGGCGA |
| dme-miR-4952-3p (MIMAT0020167): GCCGCCATTCGAATCGGGTAG |
| References |
| [1]Berezikov E, Robine N, Samsonova A, Westholm JO, Naqvi A, Hung JH, Okamura K, Dai Q, Bortolamiol-Becet D, Martin R, Zhao Y, Zamore PD, Hannon GJ, Marra MA, Weng Z, Perrimon N, Lai EC, Genome Res. 21:203-215(2011)., "Deep annotation of Drosophila melanogaster microRNAs yields insights into their processing, modification, and emergence" |