| Basic information from miRBase |
| hairpin accession number: MI0010750 |
| Located between position 70237418 and 70237483 on chromosome X strand + |
| Overlapping with sense strand of Zfp185-002 (intron 1). |
| (Ensemble: OTTMUST00000043010) |
| mature miRNAs for MI0010750: |
| mmu-miR-2137 (MIMAT0011213): GCCGGCGGGAGCCCCAGGGAG |
| You can find this miRNA in ENTREZGENE: Mir2137 (accession: 100316779) |
| References |
| [1]Sdassi N, Silveri L, Laubier J, Tilly G, Costa J, Layani S, Vilotte JL, Le Provost F, BMC Genomics. 10:149(2009)., "Identification and characterization of new miRNAs cloned from normal mouse mammary gland" |