| Basic information from miRBase |
| hairpin accession number: MI0008640 |
| Located between position 101336815 and 101336888 on chromosome 14 strand + |
| mature miRNAs for MI0008640: |
| ptr-miR-370 (MIMAT0008120): GCCTGCTGGGGTGGAACCTGGT |
| You can find this miRNA in ENTREZGENE: MIR370 (accession: 100316330) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |