| Basic information from miRBase |
| hairpin accession number: MI0014016 |
| Located between position 1003 and 1077 on chromosome gb|ABLF01021592.1| strand - |
| mature miRNAs for MI0014016: |
| api-miR-3045b (MIMAT0014796): GCCTGGTGTGCTCTTATTCTGAA |
| References |
| [1]Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S, BMC Genomics. 11:281(2010)., "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" |