| Basic information from miRBase |
| hairpin accession number: MI0012677 |
| Located between position 46536547 and 46536608 on chromosome 2 strand + |
| Overlapping with sense strand of MEGF6 (intron 3). |
| (Ensemble: ENSECAT00000014341) |
| mature miRNAs for MI0012677: |
| eca-miR-551a (MIMAT0012921): GCGACCCACTCTTGGTTTCCA |
| You can find this miRNA in ENTREZGENE: MIR551A (accession: 100315040) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |