| Basic information from miRBase |
| hairpin accession number: MI0008768 |
| Located between position 3397828 and 3397922 on chromosome 1 strand - |
| Overlapping with sense strand of XM_513736.2 (intron 3). |
| (Ensemble: ENSPTRT00000000132) |
| mature miRNAs for MI0008768: |
| ptr-miR-551a (MIMAT0008231): GCGACCCACTCTTGGTTTCCA |
| You can find this miRNA in ENTREZGENE: MIR551A (accession: 100316487) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |