| Basic information from miRBase |
| hairpin accession number: MI0008769 |
| Located between position 173737675 and 173737768 on chromosome 3 strand + |
| mature miRNAs for MI0008769: |
| ptr-miR-551b (MIMAT0008232): GCGACCCATACTTGGTTTCAG |
| You can find this miRNA in ENTREZGENE: MIR551B (accession: 100316221) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |