miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0000135

Located between position 8985263 and 8985332 on chromosome X strand +

Overlapping with sense strand of CG7033-RA (intron 2).

(Ensemble: FBtr0071289) (FlyBase: FlyBase)

mature miRNAs for MI0000135:

dme-miR-13b-2-5p (MIMAT0020797): GCGTCAAAATGACTGTGAGCTATG

dme-miR-13b-3p (MIMAT0000119): TATCACAGCCATTTTGACGAGT

You can find this miRNA in EMBL: (accession: AJ421775)

References

[1]Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T, Science. 294:853-858(2001)., "Identification of novel genes coding for small expressed RNAs"

[2]Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V, Dev Biol. 259:9-18(2003)., "Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity"

[3]Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T, Dev Cell. 5:337-350(2003)., "The small RNA profile during Drosophila melanogaster development"

[4]Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"

[5]Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M, Genome Res. 17:1865-1879(2007)., "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"

more data

Data from CoGemiR