| Basic information from miRBase |
| hairpin accession number: MI0018044 |
| Located between position 71268867 and 71268937 on chromosome X strand - |
| Overlapping with sense strand of Irak1-011 (exon 2). |
| (Ensemble: OTTMUST00000045167) |
| mature miRNAs for MI0018044: |
| mmu-miR-5132 (MIMAT0020643): GCGTGGGGTGGTGGACTCAGG |
| References |
| [1]Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison EP, Hannon GJ, Green DR, Withoff S, Blood. [Epub prior to print](2011)., "Ordered progression of stage specific miRNA profiles in the mouse B2 B cell lineage" |