| Basic information from miRBase |
| hairpin accession number: MI0015559 |
| Located between position 1671730 and 1671783 on chromosome 12q strand + |
| Overlapping with antisense strand of (intron 4). |
| (Ensemble: ENSCINT00000007886) |
| mature miRNAs for MI0015559: |
| cin-miR-4014-1-5p (MIMAT0016518): GCTACGCAGACTTTCTGTAC |
| cin-miR-4014-3p (MIMAT0016519): TTACAGAAAGCGTGTGTGTG |
| You can find this miRNA in ENTREZGENE: mir4014-1 (accession: 100498901) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |