| Basic information from miRBase |
| hairpin accession number: MI0004784 |
| Located between position 49788876 and 49788973 on chromosome 4 strand - |
| Overlapping with antisense strand of BX548011.3-201 (intron 2). |
| (Ensemble: ENSDART00000130501) |
| mature miRNAs for MI0004784: |
| dre-miR-738 (MIMAT0003769): GCTACGGCCCGCGTCGGGACCTC |
| You can find this miRNA in ENTREZGENE: mir738 (accession: 100033751) |
| References |
| [1]Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH, Nucleic Acids Res. 34:2558-2569(2006)., "Cloning and expression of new microRNAs from zebrafish" |