Basic information from miRBase |
hairpin accession number: MI0000825 |
Located between position 100774196 and 100774293 on chromosome 14 strand + |
mature miRNAs for MI0000825: |
hsa-miR-345 (MIMAT0000772): GCTGACTCCTAGTCCAGGGCTC |
You can find this miRNA in TARGETS:PICTAR-VERT: hsa-miR-345 (accession: hsa-miR-345) |
References | ||||||||||||||
[1]Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G, Proc Natl Acad Sci U S A. 101:360-365(2004)., "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" | ||||||||||||||
[2]Weber MJ, FEBS J. 272:59-73(2005)., "New human and mouse microRNA genes found by homology search" | ||||||||||||||
[3]Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X, FEBS Lett. 579:3849-3854(2005)., "Identification of human fetal liver miRNAs by a novel method" | ||||||||||||||
[4]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing" |
PROMOTER INFORMATION | ||||||||||||||
23 | chr14, 99843567-99843916, + | promoter sequence | Zhou et al. | |||||||||||
192 | chr14, 99840674-99844301, + | promoter sequence | Marson et al. | |||||||||||
976 | chr14, 99838949-99844046, + | promoter sequence | UCSC | |||||||||||
1289 | chr14, 99838433-99843432, + | promoter sequence | Ozsolak et al. (MALME) | |||||||||||
1470 | chr14, 99838418-99843417, + | promoter sequence | Ozsolak et al. (MCF7) | |||||||||||
1495 | chr14, 99838433-99843432, + | promoter sequence | Ozsolak et al. (UACC62) |
more data |
Expression data from dbDEMC |
Expression data from PhenomiR |