| Basic information from miRBase |
| hairpin accession number: MI0005019 |
| Located between position 65320259 and 65320349 on chromosome 21 strand + |
| Overlapping with antisense strand of (intron 10). |
| (Ensemble: ENSBTAT00000044914) |
| mature miRNAs for MI0005019: |
| bta-miR-345-5p (MIMAT0003800): GCTGACTCCTAGTCCAGTGCT |
| bta-miR-345-3p (MIMAT0012535): CCTGAACTAGGGGTCTGGAG |
| You can find this miRNA in ENTREZGENE: MIR345 (accession: 791018) |
| References |
| [1]Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP, Physiol Genomics. 29:35-43(2007)., "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" |
| [2]Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ, PLoS One. 4:e6349(2009)., "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" |