| Basic information from miRBase |
| hairpin accession number: MI0008811 |
| Located between position 63883084 and 63883182 on chromosome 11 strand + |
| mature miRNAs for MI0008811: |
| ptr-miR-612 (MIMAT0008274): GCTGGGCAGGGCTTCTGAGCTCCTT |
| You can find this miRNA in ENTREZGENE: MIR612 (accession: 100316495) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |