| Basic information from miRBase |
| hairpin accession number: MI0018010 |
| Located between position 137977951 and 137978037 on chromosome 7 strand + |
| Overlapping with antisense strand of Fgfr2-007 (intron 2). |
| (Ensemble: OTTMUST00000094172) |
| mature miRNAs for MI0018010: |
| mmu-miR-5102 (MIMAT0020609): GCTTCTGGCGCCAAGCTTCCGTCC |
| References |
| [1]Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison EP, Hannon GJ, Green DR, Withoff S, Blood. [Epub prior to print](2011)., "Ordered progression of stage specific miRNA profiles in the mouse B2 B cell lineage" |