| Basic information from miRBase |
| hairpin accession number: MI0008742 |
| Located between position 101478882 and 101478958 on chromosome 14 strand + |
| mature miRNAs for MI0008742: |
| ptr-miR-539 (MIMAT0008214): GGAGAAATTATCCTTGGTGTGT |
| You can find this miRNA in ENTREZGENE: MIR539 (accession: 100316528) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |