| Basic information from miRBase |
| hairpin accession number: MI0008540 |
| Located between position 70933996 and 70934062 on chromosome 11 strand - |
| Overlapping with sense strand of XM_001174720.1 (intron 1). |
| (Ensemble: ENSPTRT00000055337) |
| mature miRNAs for MI0008540: |
| ptr-miR-139 (MIMAT0008035): GGAGACGCGGCCCTGTTGGAGT |
| You can find this miRNA in ENTREZGENE: MIR139 (accession: 100316444) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |