Basic information from miRBase |
hairpin accession number: MI0015561 |
Located between position 19622 and 19671 on chromosome scaffold_806 strand - |
mature miRNAs for MI0015561: |
cin-miR-4015-5p (MIMAT0016520): ACAATGAAATTAACCTTCTC |
cin-miR-4015-3p (MIMAT0016521): GGATAGGTTGAATTCATCGT |
You can find this miRNA in ENTREZGENE: mir4015-1 (accession: 100498902) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" ![]() |