| Basic information from miRBase |
| hairpin accession number: MI0015622 |
| Located between position 1934609 and 1934658 on chromosome 9q strand + |
| Overlapping with sense strand of Q53UC2_CIOIN (intron 10). |
| (Ensemble: ENSCINT00000017225) |
| mature miRNAs for MI0015622: |
| cin-miR-4071-5p (MIMAT0016630): CTTGCTCTTACTGTGACATC |
| cin-miR-4071-3p (MIMAT0016631): GGATATCCAGACAGGGCAAA |
| You can find this miRNA in ENTREZGENE: mir4071 (accession: 100498935) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |