| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0000348 |
| Located between position 11137088 and 11137182 on chromosome V strand + |
| Overlapping with sense strand of C06H2.5b (intron 1). |
| (Ensemble: C06H2.5b) WormBase: WormBase) |
| mature miRNAs for MI0000348: |
| cel-miR-268 (MIMAT0000324): GGCAAGAATTAGAAGCAGTTTGGT |
| References |
| [1]Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J, Mol Cell. 11:1253-1263(2003)., "Computational and experimental identification of C. elegans microRNAs" |
| more data |
| Data from CoGemiR |