| Basic information from miRBase |
| hairpin accession number: MI0015758 |
| Located between position 2276825 and 2276878 on chromosome 13q strand - |
| mature miRNAs for MI0015758: |
| cin-miR-4201-5p (MIMAT0016821): GGCATTGATATGTGGGTTGG |
| You can find this miRNA in ENTREZGENE: mir4201 (accession: 100499140) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |