Basic information from miRBase |
hairpin accession number: MI0005848 |
Located between position 10032856 and 10033029 on chromosome 2R strand - |
mature miRNAs for MI0005848: |
dme-miR-989-5p (MIMAT0020887): GGCCACTACCTTGCAGTCACGTG |
dme-miR-989-3p (MIMAT0005506): TGTGATGTGACGTAGTGGAAC |
References |
[1]Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" |
more data |
Data from CoGemiR |