Basic information from miRBase |
hairpin accession number: MI0008319 |
Located between position 20836695 and 20836772 on chromosome 9 strand - |
Overlapping with antisense strand of Icam5-201 (intron 1). |
(Ensemble: ENSMUST00000019616) |
mature miRNAs for MI0008319: |
mmu-miR-1900 (MIMAT0007870): GGCCGCCCTCTCTGGTCCTTCA |
You can find this miRNA in MGI: Mir1900 (accession: 3811415) |
References |
[1]He S, Su H, Liu C, Skogerbo G, He H, He D, Zhu X, Liu T, Zhao Y, Chen R, BMC Genomics. 9:236(2008)., "MicroRNA-encoding long non-coding RNAs" ![]() |