miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0001423
Located between position 91563416 and 91563494 on chromosome X strand -
mature miRNAs for MI0001423:
         rno-miR-421 (MIMAT0001320): GGCCTCATTAAATGTTTGTTG
         rno-miR-421* (MIMAT0017175): ATCAACAGACATTAATTGGG
You can find this miRNA in ENTREZGENE: Mir421 (accession: 100314066)

References
[1]Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR, Genome Biol. 5:R68(2004)., "Microarray analysis of microRNA expression in the developing mammalian brain"
[2]Linsen SE, de Wit E, de Bruijn E, Cuppen E, BMC Genomics. 11:249(2010)., "Small RNA expression and strain specificity in the rat"