| Basic information from miRBase |
| hairpin accession number: MI0001423 |
| Located between position 91563416 and 91563494 on chromosome X strand - |
| mature miRNAs for MI0001423: |
| rno-miR-421 (MIMAT0001320): GGCCTCATTAAATGTTTGTTG |
| rno-miR-421* (MIMAT0017175): ATCAACAGACATTAATTGGG |
| You can find this miRNA in ENTREZGENE: Mir421 (accession: 100314066) |
| References |
| [1]Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR, Genome Biol. 5:R68(2004)., "Microarray analysis of microRNA expression in the developing mammalian brain" |
| [2]Linsen SE, de Wit E, de Bruijn E, Cuppen E, BMC Genomics. 11:249(2010)., "Small RNA expression and strain specificity in the rat" |