| Basic information from miRBase |
| hairpin accession number: MI0018013 |
| Located between position 147072579 and 147072660 on chromosome 5 strand + |
| Overlapping with sense strand of WU:Cdk8-005 (intron 2). |
| (Ensemble: OTTMUST00000063714) |
| mature miRNAs for MI0018013: |
| mmu-miR-5105 (MIMAT0020612): GGCGCCGCTCGTGGGGGGCC |
| References |
| [1]Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison EP, Hannon GJ, Green DR, Withoff S, Blood. [Epub prior to print](2011)., "Ordered progression of stage specific miRNA profiles in the mouse B2 B cell lineage" |