| Basic information from miRBase |
| hairpin accession number: MI0016024 |
| Located between position 822213 and 822334 on chromosome 17 strand + |
| mature miRNAs for MI0016024: |
| vvi-miR3629c (MIMAT0018024): GGCTGCTGAGAAAATGTAGGA |
| References |
| [1]Pantaleo V, Szittya G, Moxon S, Miozzi L, Moulton V, Dalmay T, Burgyan J, Plant J. 62:960-976(2010)., "Identification of grapevine microRNAs and their targets using high-throughput sequencing and degradome analysis" |