| Basic information from miRBase |
| hairpin accession number: MI0008474 |
| Located between position 98972581 and 98972682 on chromosome 8 strand - |
| Overlapping with sense strand of XM_519883.2 (intron 12). |
| (Ensemble: ENSPTRT00000050149) |
| mature miRNAs for MI0008474: |
| ptr-miR-1273 (MIMAT0007994): GGGCGACAAAGCAAGACTCTTTCTT |
| You can find this miRNA in ENTREZGENE: MIR1273 (accession: 100316434) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |