| PROMOTER INFORMATION | ||||||||||||||
| 930 | chr12, 24251622-24256696, + | promoter sequence | UCSC |  | | |||||||||
| Basic information from miRBase |
| hairpin accession number: MI0005712 |
| Located between position 24365355 and 24365429 on chromosome 12 strand + |
| mature miRNAs for MI0005712: |
| hsa-miR-920 (MIMAT0004970): GGGGAGCTGTGGAAGCAGTA |
| You can find this miRNA in HGNC: MIR920 (accession: 33670) |
| References | ||||||||||||||
| [1]Novotny GW, Nielsen JE, Sonne SB, Skakkebaek NE, Rajpert-De Meyts E, Leffers H, Int J Androl. 30:316-326(2007)., "Analysis of gene expression in normal and neoplastic human testis: new roles of RNA" | ||||||||||||||
| PROMOTER INFORMATION | ||||||||||||||
| 930 | chr12, 24251622-24256696, + | promoter sequence | UCSC | | | |||||||||