miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0012729
Located between position 70898503 and 70898599 on chromosome 6 strand +
Overlapping with sense strand of LOC100064385 (intron 1).
(Ensemble: ENSECAT00000004024)
mature miRNAs for MI0012729:
         eca-miR-615-5p (MIMAT0012976): GGGGGTCCCCGGTGCTCGGATC
         eca-miR-615-3p (MIMAT0012977): TCCGAGCCTGGGTCTCCCTCTC
You can find this miRNA in ENTREZGENE: MIR615 (accession: 100314970)

References
[1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach"