| Basic information from miRBase |
| hairpin accession number: MI0015567 |
| Located between position 1538558 and 1538610 on chromosome 3p strand - |
| Overlapping with sense strand of (intron 5). |
| (Ensemble: ENSCINT00000004458) |
| mature miRNAs for MI0015567: |
| cin-miR-4019-5p (MIMAT0016526): GGGTGCATTGCGGAGCGAGC |
| cin-miR-4019-3p (MIMAT0016527): CCCGTTCCAACAATGTTCCG |
| You can find this miRNA in ENTREZGENE: mir4019 (accession: 100498905) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |