| Basic information from miRBase |
| hairpin accession number: MI0018035 |
| Located between position 40961160 and 40961231 on chromosome 13 strand + |
| Overlapping with sense strand of Gcnt2-203 (intron 1). |
| (Ensemble: ENSMUST00000110191) |
| mature miRNAs for MI0018035: |
| mmu-miR-5124 (MIMAT0020634): GGTCCAGTGACTAAGAGCAT |
| References |
| [1]Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison EP, Hannon GJ, Green DR, Withoff S, Blood. [Epub prior to print](2011)., "Ordered progression of stage specific miRNA profiles in the mouse B2 B cell lineage" |