| Basic information from miRBase |
| hairpin accession number: MI0015496 |
| Located between position 1864796 and 1864851 on chromosome 3p strand + |
| Overlapping with sense strand of (exon 1). |
| (Ensemble: ENSCINT00000030071) |
| mature miRNAs for MI0015496: |
| cin-miR-92d-5p (MIMAT0016423): GGTCGTGTTTGGTGTATCAT |
| cin-miR-92d-3p (MIMAT0016424): TATTGCACCTGTCCCGGCCG |
| You can find this miRNA in ENTREZGENE: mir92d (accession: 100498869) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |