miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0004780
Located between position 33755561 and 33755653 on chromosome 1 strand +
Overlapping with sense strand of epha6-001 (intron 3).
(Ensemble: OTTDART00000030233)
mature miRNAs for MI0004780:
         dre-miR-734 (MIMAT0003765): GTAAATGCTGCAGAATCGTACCG
You can find this miRNA in ENTREZGENE: mir734 (accession: 100033747)

References
[1]Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH, Nucleic Acids Res. 34:2558-2569(2006)., "Cloning and expression of new microRNAs from zebrafish"